TrkC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

TrkC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1839 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens neurotrophic tyrosine kinase receptor, type 3, transcript variant 3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

TrkC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

gp145(trkC) cDNA ORF Clone, Human; TRKC cDNA ORF Clone, Human

TrkC Background Information

NT-3 growth factor receptor also known as neurotrophic tyrosine kinase receptor type 3 or TrkC tyrosine kinase or Trk-C receptor, is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. TrkC/NTRK3 is widely expressed in the developing and adult nervous system. In later embryonic development, TrkC/NTRK3 is expressed in various structures of the CNS including the caudatoputamen, septal nuclei, cerebellum, and brainstem. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. In the PNS, trkC hybridization appears to correlate, both temporally and spatially, with the outgrowth of axons toward their peripheral targets. TrkC/NTRK3 is widely expressed in the three identified branches of the mammalian nervous system and appears to correlate with the expression of NT-3, its cognate ligand. The apparent colocalization of trkC transcripts with NT-3 raises the possibility this neurotrophin exerts its trophic effects by a paracrine and/or autocrine mechanism. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in TrkC encoding gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers.
Full Name
neurotrophic tyrosine kinase, receptor, type 3
References
  • Tessarollo L, et al. (1993) trkC, a receptor for neurotrophin-3, is widely expressed in the developing nervous system and in non-neuronal tissues. Development. 118(2): 463-75.
  • Lamballe F, et al. (1994) Developmental expression of trkC, the neurotrophin-3 receptor, in the mammalian nervous system. J Neurosci. 14(1): 14-28.
  • Klein R, et al. (1994) Disruption of the neurotrophin-3 receptor gene trkC eliminates la muscle afferents and results in abnormal movements. Nature. 368(6468): 249-51.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait