FTO cDNA ORF Clone, Rat, untagged

Price:
Size:
Number:

FTO cDNA ORF Clone, Rat, untagged: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1509 bp
Description
Full length Clone DNA of Rat fat mass and obesity associated.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FTO Background Information

Polymorphisms in the FTO gene are associated with obesity and body mass index in humans and livestock. Fat mass and obesity-associated (FTO) protein is a ferrous ion (Fe2+)/2-oxoglutarate (2-OG)-dependent demethylase preferentially catalyzing m6A sites in RNA. The FTO gene is highly expressed in the hypothalamus with fluctuation in response to various nutritional conditions, which is believed to be involved in the control of whole body metabolism. The fat mass and obesity-related (FTO) gene has a strong relationship with obesity, extreme obesity and inflammatory state, and may also be associated with food intake regulation. SNPs in the first intron of FTO convey effects on adiposity by mechanisms that remain unclear, but appear to include modulation of expression of FTO itself, as well as other genes in cis. FTO expression is lower in fibroblasts and iPSC-derived neurons of individuals segregating for FTO obesity risk alleles. The overexpression of FTO had been demonstrated that in mouse models of MI decreased fibrosis and enhanced angiogenesis.
Full Name
fat mass and obesity associated
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait