Ephrin-A1 cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

Ephrin-A1 cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Rat ephrin A1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Ephrin-A1 Background Information

EPH-related receptor tyrosine kinase ligand 1 (abbreviated as Ephrin-A1) also known as ligand of eph-related kinase 1 or EFNA1, is a member of the ephrin (EPH) family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin-A1/EFNA1 and its Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A1 and one of its receptor EphA2 were expressed in xenograft endothelial cells and also tumor cells and play a role in human cancers, at least in part by influencing tumor neovascularization.
Full Name
ephrin-A1
References
  • Deroanne C, et al. (2003) EphrinA1 inactivates integrin-mediated vascular smooth muscle cell spreading via the Rac/PAK pathway. J Cell Sci. 116(7): 1367-76.
  • Ojima T, et al. (2006) EphrinA1 inhibits vascular endothelial growth factor-induced intracellular signaling and suppresses retinal neovascularization and blood-retinal barrier breakdown. Am J Pathol. 168(1): 331-9.
  • Wu D, et al. (2004) Prognostic value of EphA2 and EphrinA-1 in squamous cell cervical carcinoma. Gynecol Oncol. 94(2): 312-9.

Ephrin-A1 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait