CD25 / IL2RA cDNA ORF Clone, Rat, C-OFPSpark® tag

Price:
Size:
Number:

CD25 / IL2RA cDNA ORF Clone, Rat, C-OFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
804 bp
Description
Full length Clone DNA of Rat interleukin 2 receptor, alpha with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD25 / IL2RA Background Information

CD25 (alpha-chain of IL-2 receptor, or IL2RA), is a type I transmembrane glycoprotein with a signal peptide, an extracellular region, a transmembrane region, and a cytoplasmic domain. IL2RA is expressed on activated T cells and regulatory T cells, and is capable of binding IL2 with low affinity by itself. However, a ligand-induced high affinity heterotrimeric receptor complex is produced when IL2RA is associated non-covelently with the IL2 receptor beta and gamma chain, and subsequently initiates the intacellular signal pathways such as MAPK or JAK/STAT. On dendritic cells (DC), CD25 has been previously regarded as an activation marker, while both murine and human DC can express CD25, they do not express the beta-chain of the IL-2 receptor, which is indispensable for the execution of IL-2 signaling. The IL2RA (CD25) gene is a substantial component of the high-affinity receptor molecule highly expressed by activated T lymphocytes. Recently, a strong evidence was obtained for the involvement of IL-2RA in conferring susceptibility to type 1 diabetes (T1D). Cancer growth and development is associated with the stimulation of the innate immune system, including enhanced interleukin 2 receptor (IL-2R) expression in immune cells and its shedding into the circulation in a soluble form of sIL-2Ralpha. In most haematological malignancies, including different types of leukaemias and lymphomas, sIL-2Ralpha has been found to be released directly from the surface of neoplastic cells thus reflecting the tumour bulk, turnover and activity. Several studies have proved that not only lymphoid cancer cells, but also some non-lymphoid cancer cells, express IL-2R on their surface. They include malignant melanoma and carcinomas of the kidney, head and neck, oesophagus and lung. Thus, sIL-2Ralpha is elevated in most proliferative disturbances of the hematopoietic system and in many solid tumors.
Full Name
interleukin 2 receptor, alpha
References
  • Driesen J, et al. (2008) CD25 as an immune regulatory molecule expressed on myeloid dendritic cells. Immunobiology. 213(9-10): 849-58.
  • Olejniczak K, et al. (2008) Biological properties of interleukin 2 and its role in pathogenesis of selected diseases--a review. Med Sci Monit. 14(10): RA179-89.
  • Chistiakov DA, et al. (2008) The crucial role of IL-2/IL-2RA-mediated immune regulation in the pathogenesis of type 1 diabetes, an evidence coming from genetic and animal model studies. Immunol Lett. 118(1): 1-5.
  • Bien E, et al. (2008) Serum soluble interleukin 2 receptor alpha in human cancer of adults and children: a review. Biomarkers. 13(1): 1-26.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait