beta-Actin cDNA ORF Clone, Rat, untagged

Price:
Size:
Number:

beta-Actin cDNA ORF Clone, Rat, untagged: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Description
Full length Clone DNA of Rat actin, beta.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta-Actin Background Information

ACTB (Actin Beta) is a Protein Coding gene. Diseases associated with ACTB include Dystonia, Juvenile-Onset and Baraitser-Winter Syndrome 1. Among its related pathways are Salivary secretion and Development Slit-Robo signaling. Gene Ontology (GO) annotations related to this gene include identical protein binding and RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is ACTG1. TUBB, HPRT and ACTB were the most stably expressed genes for all analysis groups across meningioma and non-pathological meningeal tissue combined. ACTB, a significant upregulated gene in abdominal aortic aneurysm samples, could be regulated by CLIC4, which was significantly enriched in cell motions. Dystonia-deafness syndrome is a well-known clinical entity, with sensorineural deafness typically manifesting earlier than dystonia. ACTB p.Arg183Trp heterozygosity has been reported in six patients to cause combined infant-onset deafness and dystonia manifesting in adolescence or young adulthood.
Full Name
actin, beta
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait