beta-Actin cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

beta-Actin cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Description
Full length Clone DNA of Rat actin, beta with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta-Actin Background Information

ACTB (Actin Beta) is a Protein Coding gene. Diseases associated with ACTB include Dystonia, Juvenile-Onset and Baraitser-Winter Syndrome 1. Among its related pathways are Salivary secretion and Development Slit-Robo signaling. Gene Ontology (GO) annotations related to this gene include identical protein binding and RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is ACTG1. TUBB, HPRT and ACTB were the most stably expressed genes for all analysis groups across meningioma and non-pathological meningeal tissue combined. ACTB, a significant upregulated gene in abdominal aortic aneurysm samples, could be regulated by CLIC4, which was significantly enriched in cell motions. Dystonia-deafness syndrome is a well-known clinical entity, with sensorineural deafness typically manifesting earlier than dystonia. ACTB p.Arg183Trp heterozygosity has been reported in six patients to cause combined infant-onset deafness and dystonia manifesting in adolescence or young adulthood.
Full Name
actin, beta
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait