PCSK9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

PCSK9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2076 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus vascular endothelial growth factor A.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

PCSK9 Background Information

Proprotein convertase subtilisin/kexin type 9 (PCSK9), also known as NARC1 (neural apoptosis regulated convertase), which is a newly identified human secretory subtilase belonging to the proteinase K subfamily of the secretory subtilase family. PCSK9 protein is an enzyme which in humans is encoded by the PCSK9 gene with orthologs found across many species. It is expressed in neuroepithelioma, colon carcinoma, hepatic and pancreatic cell lines, and in Schwann cells. PCSK9 protein is highly expressed in the liver and regulates low density lipoprotein receptor (LDLR) protein levels. Inhibition of PCSK9 protein function is currently being explored as a means of lowering cholesterol levels. Thereby, PCSK9 protein is regarded as a new strategy to treat hypercholesterolemia. PCSK9 protein contributes to cholesterol homeostasis and may have a role in the differentiation of cortical neurons.

References

Full Name
proprotein convertase subtilisin/kexin type 9
References
  • Sseidah, N.G. et al., 2003, Proc. Natl. Acad. Sci. USA. 100: 928-933.
  • Beyer, T.P. et al., 2007, J. Lipid. Res. 48: 1488-1498
  • Shan, L. et al., 2008, Biochem. Biophys. Res. Commun. 375: 69-73.
  • Benjannet, S. et al., 2005, J. Biol. Chem. 279: 48865-48875.
  • Abifadel, M. et al., 2003, Nat. Genet. 34: 154-156.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait