pCMV3-C-FLAG

pCMV3-C-FLAG Physical Map
Download sequence
pCMV3-C-FLAG Physical Map

Comments for pCMV3-C-FLAG:

  • • CMV promoter: bases 250-837
  • • Enhancer: bases 838-1445
  • • SV40 early promoter: bases 2399-2768
  • • Hygromycin ORF: bases 2786-3811
  • • pUC origin: bases 4454-5127
  • • Kanamycin ORF: bases 5201-6016

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-C-FLAG Information Description

Vector Name pCMV3-C-FLAG
Vector Size 6158bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Mammalian Expression Vectors

More Reagents and Services