SLITL2 / VASN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

SLITL2 / VASN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2061 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1227C/T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse vasorin with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+2.06kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SLITL2 / VASN cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

More Information About SLITL2 / VASN

Entrez Gene ID

SLITL2 / VASN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Validated Images

SLITL2 / VASN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

2610528G05Rik cDNA ORF Clone, Mouse; Atia cDNA ORF Clone, Mouse; Slitl2 cDNA ORF Clone, Mouse

SLITL2 / VASN Background Information

Vasorin is a typical type I membrane protein. It contains 1 EGF-like domain, 1 fibronectin type-III domain, 1 LRR (leucine-rich) repeats, 1 LRRCT domain and 1 LRRNT domain. Vasorin is predominantly expressed in vascular smooth muscle cells, and that its expression is developmentally regulated. vasorin It directly binds to transforming growth factor (TGF)-β and attenuates TGF-β signaling in vitro. This suggests that down-regulation of vasorin expression contributes to neointimal formation after vascular injury and that vasorin modulates cellular responses to pathological stimuli in the vessel wall.
Full Name
vasorin
References
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Lee KA, et al. (2011) Ubiquitin ligase substrate identification through quantitative proteomics at both the protein and peptide levels. J Biol Chem. 286(48):41530-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait