GM-CSF cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/2
Price:
Size:
Number:

GM-CSF cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
426 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse colony stimulating factor 2 (granulocyte-macrophage) with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 1.16kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GM-CSF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GM-CSF cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

GM-CSF cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

Csfgm cDNA ORF Clone, Mouse; Gm-CSf cDNA ORF Clone, Mouse; GMCSF cDNA ORF Clone, Mouse; MGI-IGM cDNA ORF Clone, Mouse

GM-CSF Background Information

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is one of an array of cytokines with pivotal roles in embryo implantation and subsequent development. Several cell lineages in the reproductive tract and gestational tissues synthesise GM-CSF under direction by ovarian steroid hormones and signalling agents originating in male seminal fluid and the conceptus. The pre-implantation embryo, invading placental trophoblast cells and the abundant populations of leukocytes controlling maternal immune tolerance are all subject to GM-CSF regulation. GM-CSF stimulates the differentiation of hematopoietic progenitors to monocytes and neutrophils, and reduces the risk for febrile neutropenia in cancer patients. GM-CSF also has been shown to induce the differentiation of myeloid dendritic cells (DCs) that promote the development of T-helper type 1 (cellular) immune responses in cognate T cells. The active form of the protein is found extracellularly as a homodimer, and the encoding gene is localized to a related gene cluster at chromosome region 5q31 which is known to be associated with 5q-syndrome and acute myelogenous leukemia. As a part of the immune/inflammatory cascade, GM-CSF promotes Th1 biased immune response, angiogenesis, allergic inflammation, and the development of autoimmunity, and thus worthy of consideration for therapeutic target. GM-CSF has been utilized in the clinical management of multiple disease processes. Most recently, GM-CSF has been incorporated into the treatment of malignancies as a sole therapy, as well as a vaccine adjuvant. While the benefits of GM-CSF in this arena have been promising, recent reports have suggested the potential for GM-CSF to induce immune suppression and, thus, negatively impact outcomes in the management of cancer patients. GM-CSF deficiency in pregnancy adversely impacts fetal and placental development, as well as progeny viability and growth after birth, highlighting this cytokine as a central maternal determinant of pregnancy outcome with clinical relevance in human fertility.
Full Name
colony stimulating factor 2 (granulocyte-macrophage)
References
  • Robertson SA. (2007) GM-CSF regulation of embryo development and pregnancy. Cytokine Growth Factor Rev. 18(3-4): 287-98.
  • Waller EK. (2007) The role of sargramostim (rhGM-CSF) as immunotherapy. Oncologist. 12 Suppl 2: 22-6.
  • Clive KS, et al. (2010) Use of GM-CSF as an adjuvant with cancer vaccines: beneficial or detrimental? Expert Rev Vaccines. 9(5): 519-25.

GM-CSF cDNA ORF Clone, Cynomolgus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait