CCT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CCT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1638 bp
Description
Full length Clone DNA of Mouse chaperonin containing Tcp1, subunit 3 (gamma) with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About CCT3

Entrez Gene ID

CCT3 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

AL024092 cDNA ORF Clone, Mouse; Cctg cDNA ORF Clone, Mouse; Tcp1-rs3 cDNA ORF Clone, Mouse; TriC-P5 cDNA ORF Clone, Mouse

CCT3 Background Information

Full Name
chaperonin containing TCP1, subunit 3 (gamma)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait