ASB13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Price:
Size:
Number:

ASB13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
837 bp
Description
Full length Clone DNA of Mouse ankyrin repeat and SOCS box-containing 13 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ASB13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag: Alternative Names

2210015B19Rik cDNA ORF Clone, Mouse; 6430573K02Rik cDNA ORF Clone, Mouse; Asb-13 cDNA ORF Clone, Mouse; C85285 cDNA ORF Clone, Mouse

ASB13 Background Information

Full Name
ankyrin repeat and SOCS box containing 13
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait