ABCE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

ABCE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1800 bp
Description
Full length Clone DNA of Mouse ATP-binding cassette, sub-family E (OABP), member 1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ABCE1 cDNA ORF Clone, Mouse, C-OFPSpark® tag: Alternative Names

C79080 cDNA ORF Clone, Mouse; Oabp cDNA ORF Clone, Mouse; RLI cDNA ORF Clone, Mouse; Rnaseli cDNA ORF Clone, Mouse; RNS41 cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait