AASS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Price:
Size:
Number:

AASS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2781 bp
Description
Full length Clone DNA of Mouse aminoadipate-semialdehyde synthase with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About AASS

Entrez Gene ID

AASS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag: Alternative Names

LKR cDNA ORF Clone, Mouse; LKR/SDH cDNA ORF Clone, Mouse; LOR cDNA ORF Clone, Mouse; LOR/SDH cDNA ORF Clone, Mouse; Lorsdh cDNA ORF Clone, Mouse; SDH cDNA ORF Clone, Mouse

AASS Background Information

Full Name
aminoadipate-semialdehyde synthase
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait