MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag

1/2
Price:
Size:
Number:

MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag: General Information

Gene
Species
MERS-CoV
RefSeq ORF Size
4062 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFS88936.1.
Description
Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) Spike protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 4.1kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CoV spike cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag: Alternative Names

S cDNA ORF Clone, MERS-CoV

CoV spike Background Information

The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host cell: they are essential for both host specificity and viral infectivity. The term 'peplomer' is typically used to refer to a grouping of heterologous proteins on the virus surface that function together. The spike (S) glycoprotein of coronaviruses is known to be essential in the binding of the virus to the host cell at the advent of the infection process. Most notable is severe acute respiratory syndrome (SARS). The severe acute respiratory syndrome-coronavirus (SARS-CoV) spike (S) glycoprotein alone can mediate the membrane fusion required for virus entry and cell fusion. It is also a major immunogen and a target for entry inhibitors. The SARS-CoV spike (S) protein is composed of two subunits; the S1 subunit contains a receptor-binding domain that engages with the host cell receptor angiotensin-converting enzyme 2 and the S2 subunit mediates fusion between the viral and host cell membranes. The S protein plays key parts in the induction of neutralizing-antibody and T-cell responses, as well as protective immunity, during infection with SARS-CoV.
References
  • Shen S, et al. (2007) Expression, glycosylation, and modification of the spike (S) glycoprotein of SARS CoV. Methods Mol Biol. 379: 127-35.
  • Du L, et al. (2009) The spike protein of SARS-CoV--a target for vaccine and therapeutic development. Nat Rev Microbiol. 7 (3): 226-36.
  • Xiao X, et al. (2004) The SARS-CoV S glycoprotein. Cell Mol Life Sci. 61 (19-20): 2428-30.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait