Interferon alpha 2 / IFNA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Interferon alpha 2 / IFNA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
RefSeq ORF Size
567 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with NP_000596.2.
Description
Full length Clone DNA of Homo sapiens interferon, alpha 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Interferon alpha 2 / IFNA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

IFN-alphaA cDNA ORF Clone, Human; IFNA cDNA ORF Clone, Human; IFNA2B cDNA ORF Clone, Human; IFNAB cDNA ORF Clone, Human; INFA2 cDNA ORF Clone, Human; Interferon alpha 2 cDNA ORF Clone, Human

Interferon alpha 2 / IFNA2 Background Information

Type I Interferons (IFNs) are well known cytokines which exert antiviral activity, antitumor activity and immunomodulatory effects. Interferon tau (IFNT), a type I IFN similar to alpha IFNs (IFNA), is the pregnancy recognition signal produced by the ruminant conceptus. Among IFN-α genes, a total of 28 different sequence variants have been described.The three principal subtypes of IFNα-2 are designated α-2a, α-2b, and α-2c. IFNα-2b is being the predominant allele while IFNα-2a is less predominant and IFNα-2c only a minor allelic variant.
Full Name
interferon, alpha 2
References
  • Wang, et al. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.
  • Groopman JE, et al. (1984) Recombinant alpha-2 interferon therapy for Kaposi's sarcoma associated with the acquired immunodeficiency syndrome. Ann Intern Med. 100(5): 671-6.
  • Krueger JM, et al. (1987) Interferon alpha-2 enhances slow-wave sleep in rabbits. Int J Immunopharmacol. 9(1): 23-30.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait