IL-6R Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag

Price:
Size:
Number:

IL-6R Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Macaca mulatta (Rhesus monkey) interleukin 6 receptor.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IL-6R Background Information

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp13. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp13 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.
Full Name
interleukin 6 receptor
References
  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.

IL-6R cDNA ORF Clone, Rat, Related Products

IL-6R cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait