IL-15 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

IL-15 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
489 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus interleukin 15.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

IL-15 Background Information

The protein encoded by IL15 gene is a cytokine that regulates T and natural killer cell activation and proliferation. This cytokine and interleukine 2 share many biological activities. They are found to bind common hematopoietin receptor subunits, and may compete for the same receptor, and thus negatively regulate each other's activity. The number of CD8+ memory cells is shown to be controlled by a balance between this cytokine and IL2. This cytokine induces the activation of JAK kinases, as well as the phosphorylation and activation of transcription activators STAT3, STAT5, and STAT6. Studies of the mouse counterpart suggested that this cytokine may increase the expression of apoptosis inhibitor BCL2L1/BCL-x(L), possibly through the transcription activation activity of STAT6, and thus prevent apoptosis. Alternatively spliced transcript variants of this gene have been reported.
Full Name
interleukin 15
References
  • Mongini PKA, Gupta R, Boyle E, et al. TLR-9 and IL-15 synergy promotes the in vitro clonal expansion of chronic lymphocytic leukemia B cells. Journal of immunology (Baltimore, Md : 1950). 2015;195(3):901-923.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait