IMPACT cDNA ORF Clone, Human, C-OFPSpark® tag

Price:
Size:
Number:

IMPACT cDNA ORF Clone, Human, C-OFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
963 bp
Description
Full length Clone DNA of Human impact RWD domain protein with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IMPACT cDNA ORF Clone, Human, C-OFPSpark® tag: Alternative Names

RWDD5 cDNA ORF Clone, Human

IMPACT Background Information

Full Name
impact, RWD domain protein
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait