IL1-F8 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

IL1-F8 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
474 bp
Description
Full length Clone DNA of Human interleukin 1 family, member 8 (eta), transcript variant 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL1-F8 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

FIL1 cDNA ORF Clone, Human; FIL1-(ETA) cDNA ORF Clone, Human; FIL1H cDNA ORF Clone, Human; FILI-(ETA) cDNA ORF Clone, Human; IL-1F8 cDNA ORF Clone, Human; IL-1H2 cDNA ORF Clone, Human; IL1-ETA cDNA ORF Clone, Human; IL1F8 cDNA ORF Clone, Human; IL1H2 cDNA ORF Clone, Human; IL36B cDNA ORF Clone, Human

IL1-F8 Background Information

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.
Full Name
interleukin 36, beta
References
  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait