IL3 cDNA ORF Clone, Human, N-Myc tag

1/1
Price:
Size:
Number:

IL3 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
459 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 3 (colony-stimulating factor, multiple) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI+XbaI (6kb+0.5kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL3 cDNA ORF Clone, Human, N-Myc tag: Validated Images

IL3 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

IL-3 cDNA ORF Clone, Human; Interleukin-3 cDNA ORF Clone, Human; MCGF cDNA ORF Clone, Human; MULTI-CSF cDNA ORF Clone, Human

IL3 Background Information

IL3 (interleukin 3), also known as IL-3, is a potent growth promoting cytokine which belongs to the IL-3 family. IL3/IL-3 also belongs to the group of interleukins. Interleukins are produced by a wide variety of body cells. The function of the immune system depends in a large part on interleukins, and rare deficiencies of a number of them have been described, all featuring autoimmune diseases or immune deficiency. The majority of interleukins are synthesized by helper CD4+ T lymphocytes, as well as through monocytes, macrophages, and endothelial cells. They promote the development and differentiation of T, B, and hematopoietic cells. IL3/IL-3 is capable of supporting the proliferation of a broad range of hematopoietic cell types. It is involved in a variety of cell activities such as cell growth, differentiation and apoptosis. IL3/IL-3 has been shown to also possess neurotrophic activity, and it may be associated with neurologic disorders.
Full Name
interleukin 3
References
  • Meyer CG, et al.. (2011) IL3 variant on chromosomal region 5q31-33 and protection from recurrent malaria attacks. Hum Mol Genet. 20(6):1173-81.
  • Zambrano A, et al. (2010) IL-3 controls tau modifications and protects cortical neurons from neurodegeneration. Curr Alzheimer Res. 7(7):615-24.
  • Dentelli P, et al.. (2011) IL-3 is a novel target to interfere with tumor vasculature. Oncogene. 30(50):4930-40.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait