ICAM-2 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

ICAM-2 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
828 bp
Description
Full length Clone DNA of Human intercellular adhesion molecule 2 (ICAM2), transcript variant 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ICAM-2 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

CD102 cDNA ORF Clone, Human

ICAM-2 Background Information

Intercellular adhesion molecule 2 (ICAM-2, CD12), belongs to the ICAM family consisting of three members identified as ligands for integrin receptors. It is a type I transmembrane glycoprotein with two Ig-like C2-type domains, and binds to the leukocyte integrins LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). As a second ligand of leukocyte function-associated antigen-1, ICAM-2 functions as a costimulatory molecule for effector cells. ICAM-2 is mainly expressed on vascular endothelial and hematopoietic cells. Interactions of ICAM-2 and the integrin receptors mediate cell adhesion in a wide range of lymphocyte, monocyte, natural killer cell, and granulocytewith other cells, and play important roles in many adhesion-dependent immune and inflammation responses, such as T cell aggregation, NK-cell cytotoxicity and migration, lymphocyte recirculation, etc. Serum levels of ICAM-2 correlated significantly with the inflammatory and course sequences of trichinosis in mice and had a similar relation with blood eosinophilia. So, estimation of ICAM-2 serum levels may prove useful in diagnosis of trichinosis recent infections, and in monitoring the prognosis and response to treatment.
Full Name
intercellular adhesion molecule 2
References
  • Weber KS, et al. (2004) Sialylation of ICAM-2 on platelets impairs adhesion of leukocytes via LFA-1 and DC-SIGN. Inflammation. 28(4): 177-88.
  • Tanaka H, et al. (2004) ICAM-2 gene therapy for peritoneal dissemination of scirrhous gastric carcinoma. Clin Cancer Res. 10(14): 4885-92.
  • Younis AI, et al. (2005) Intercellular adhesion molecule-2 (ICAM-2) in experimental trichinosis. J Egypt Soc Parasitol. 35(3): 1019-26.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait