Hsp27 / HSPB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Price:
Size:
Number:

Hsp27 / HSPB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Human heat shock 27kDa protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Hsp27 / HSPB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CMT2F cDNA ORF Clone, Human; HEL-S-102 cDNA ORF Clone, Human; HMN2B cDNA ORF Clone, Human; HS.76067 cDNA ORF Clone, Human; Hsp25 cDNA ORF Clone, Human; HSP27 cDNA ORF Clone, Human; HSP28 cDNA ORF Clone, Human; SRP27 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait