FTO cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

FTO cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fat mass and obesity associated with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.56kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FTO cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FTO cDNA ORF Clone, Human, C-His tag: Validated Images

FTO cDNA ORF Clone, Human, C-His tag: Alternative Names

ALKBH9 cDNA ORF Clone, Human

FTO Background Information

Polymorphisms in the FTO gene are associated with obesity and body mass index in humans and livestock. Fat mass and obesity-associated (FTO) protein is a ferrous ion (Fe2+)/2-oxoglutarate (2-OG)-dependent demethylase preferentially catalyzing m6A sites in RNA. The FTO gene is highly expressed in the hypothalamus with fluctuation in response to various nutritional conditions, which is believed to be involved in the control of whole body metabolism. The fat mass and obesity-related (FTO) gene has a strong relationship with obesity, extreme obesity and inflammatory state, and may also be associated with food intake regulation. SNPs in the first intron of FTO convey effects on adiposity by mechanisms that remain unclear, but appear to include modulation of expression of FTO itself, as well as other genes in cis. FTO expression is lower in fibroblasts and iPSC-derived neurons of individuals segregating for FTO obesity risk alleles. The overexpression of FTO had been demonstrated that in mouse models of MI decreased fibrosis and enhanced angiogenesis.
Full Name
fat mass and obesity associated
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait