DICER1 cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

DICER1 cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
5814 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 141T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human dicer 1, ribonuclease type I II with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+5.81kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DICER1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DICER1 cDNA ORF Clone, Human, C-His tag: Validated Images

DICER1 cDNA ORF Clone, Human, C-His tag: Alternative Names

DCR1 cDNA ORF Clone, Human; Dicer cDNA ORF Clone, Human; Dicer1e cDNA ORF Clone, Human; HERNA cDNA ORF Clone, Human; K12H4.8-LIKE cDNA ORF Clone, Human; MNG1 cDNA ORF Clone, Human; RMSE2 cDNA ORF Clone, Human

DICER1 Background Information

Full Name
dicer 1, ribonuclease type III
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait