CXCL14 cDNA ORF Clone, Human, C-HA tag

Price:
Size:
Number:

CXCL14 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
300 bp
Description
Full length Clone DNA of Human chemokine (C-X-C motif) ligand 14 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CXCL14 cDNA ORF Clone, Human, C-HA tag: Alternative Names

BMAC cDNA ORF Clone, Human; BRAK cDNA ORF Clone, Human; KEC cDNA ORF Clone, Human; KS1 cDNA ORF Clone, Human; MIP-2g cDNA ORF Clone, Human; MIP2G cDNA ORF Clone, Human; NJAC cDNA ORF Clone, Human; SCYB14 cDNA ORF Clone, Human

CXCL14 Background Information

CXCL14 is a CXC chemokine family that exhibits antimicrobial activity and contains an amphipathic cationic alpha-helical region in the C-terminus, a characteristic structure of antimicrobial peptides (AMPs). CXCL14 is involved in cell recruitment, migration, activation, and homing in liver diseases and have been shown to be upregulated during acute liver injury in animal models. The CXC chemokine ligand 14 (CXCL14) had been show highly expressed in tumor-associated stromal cells, promoting tumor cell growth, and invasion. The stimulation of dysregulated CXCL14 expression by P. gingivalis may help promote dysbiosis and the development of chronic periodontitis. The level of CXCL14 expression may be a valuable adjuvant parameter to predict the prognosis of patients with oral carcinoma and may be a potential therapeutic target.
Full Name
chemokine (C-X-C motif) ligand 14
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait