Interferon alpha 2 / IFNA2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Price:
Size:
Number:

Interferon alpha 2 / IFNA2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
567 bp
Description
Full length Clone DNA of Rhesus interferon, alpha 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Interferon alpha 2 / IFNA2 Background Information

Type I Interferons (IFNs) are well known cytokines which exert antiviral activity, antitumor activity and immunomodulatory effects. Interferon tau (IFNT), a type I IFN similar to alpha IFNs (IFNA), is the pregnancy recognition signal produced by the ruminant conceptus. Among IFN-α genes, a total of 28 different sequence variants have been described.The three principal subtypes of IFNα-2 are designated α-2a, α-2b, and α-2c. IFNα-2b is being the predominant allele while IFNα-2a is less predominant and IFNα-2c only a minor allelic variant.
Full Name
interferon, alpha 2
References
  • Wang, et al. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.
  • Groopman JE, et al. (1984) Recombinant alpha-2 interferon therapy for Kaposi's sarcoma associated with the acquired immunodeficiency syndrome. Ann Intern Med. 100(5): 671-6.
  • Krueger JM, et al. (1987) Interferon alpha-2 enhances slow-wave sleep in rabbits. Int J Immunopharmacol. 9(1): 23-30.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait