CD4 cDNA ORF Clone, Rhesus, C-HA tag

Price:
Size:
Number:

CD4 cDNA ORF Clone, Rhesus, C-HA tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1377 bp
Description
Full length Clone DNA of Rhesus CD40 ligand with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD4 Background Information

T-cell surface glycoprotein CD4, is a single-pass type I membrane protein. CD4 contains three Ig-like C2-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. CD4 is a glycoprotein expressed on the surface of T helper cells, regulatory T cells, monocytes, macrophages, and dendritic cells. The CD4 surface determinant, previously associated as a phenotypic marker for helper/inducer subsets of T lymphocytes, has now been critically identified as the binding/entry protein for human immunodeficiency viruses (HIV). The human CD4 molecule is readily detectable on monocytes, T lymphocytes, and brain tissues. All human tissue sources of CD4 bind radiolabeled gp120 to the same relative degree; however, the murine homologous protein, L3T4, does not bind the HIV envelope protein. CD4 is a co-receptor that assists the T cell receptor (TCR) to activate its T cell following an interaction with an antigen-presenting cell. Using its portion that resides inside the T cell, CD4 amplifies the signal generated by the TCR. CD4 interacts directly with MHC class II molecules on the surface of the antigen-presenting cell via its extracellular domain. The CD4 molecule is currently the object of intense interest and investigation both because of its role in normal T-cell function, and because of its role in HIV infection. CD4 is a primary receptor used by HIV-1 to gain entry into host T cells. HIV infection leads to a progressive reduction of the number of T cells possessing CD4 receptors.

Viral protein U (VpU) of HIV-1 plays an important role in downregulation of the main HIV-1 receptor CD4 from the surface of infected cells. Physical binding of VpU to newly synthesized CD4 in the endoplasmic reticulum is an early step in a pathway leading to proteasomal degradation of CD4. Amino acids in both helices found in the cytoplasmic region of VpU in membrane-mimicking detergent micelles experience chemical shift perturbations upon binding to CD4, whereas amino acids between the two helices and at the C-terminus of VpU show no or only small changes, respectively. Paramagnetic spin labels were attached at three sequence positions of a CD4 peptide comprising the transmembrane and cytosolic domains of the receptor. VpU binds to a membrane-proximal region in the cytoplasmic domain of CD4.
Full Name
CD4 molecule
Related Pathways
  • NF-kB (NFkB) Pathway
    NF-kB (NFkB) Pathway
  • T Cell Receptor Signaling Pathway
    T Cell Receptor Signaling Pathway
References
  • Farrar WL, et al. (1988) Characterization of CD4 glycoprotein determinant-HIV envelope protein interactions: perspectives for analog and vaccine development. Crit Rev Immunol. 8(4): 315-39.
  • Biddison WE, et al. (1989) CD4 expression and function in HLA class II-specific T cells. Immunol Rev. 109: 5-15.
  • Singh SK, et al. (2012) Mapping the interaction between the cytoplasmic domains of HIV-1 viral protein U and human CD4 with NMR spectroscopy. FEBS J. 279(19):3705-14.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.