CD160 cDNA ORF Clone, Rhesus, C-His tag

Price:
Size:
Number:

CD160 cDNA ORF Clone, Rhesus, C-His tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Rhesus CD160 molecule with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD160 Background Information

CD16 antigen, also known as Natural killer cell receptor BY55 and CD16, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD16 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD16 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD16 is expressed in spleen, peripheral blood, and small intestine. Expression of CD16 is restricted to functional NK and T cytotoxic lymphocytes. CD16 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD16+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD16+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD16 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.
Full Name
CD160 molecule
References
  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.