TIM-3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

TIM-3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
765 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus hepatitis A virus cellular receptor 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

More Information About TIM-3

Entrez Gene ID

TIM-3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: Alternative Names

tim3 cDNA ORF Clone, Rat

TIM-3 Background Information

Hepatitis A virus cellular receptor 2 (HAVCR2), formerly known as T cell immunoglobulin and mucin domain-3 (TIM-3), is a transmembrane glycoprotein expressed on the surface of terminally differentiated Th1 cells but not on Th2 cells. It was the first surface molecule that specifically identifies Th1 cells in both mice and human. Recently, identification of Galectin-9 as a ligand for TIM-3 has established the TIM-3-Galectin-9 pathway as an important regulator of Th1 immunity and tolerance induction. Engagement of Tim-3 by its ligand galectin-9 negatively regulates IFN-gamma secretion and influences the ability to induce T cell tolerance in both mice and man. It suggests a novel paradigm in which dysregulation of the TIM-3-galectin-9 pathway could underlie chronic autoimmune disease states, such as multiple sclerosis. Recent work has explored the role of TIM-3 in systemic lupus erythematosus (SLE), and their results indicate that TIM-3 may represent a novel target for the treatment of SLE. Numerous studies have demonstrated that Tim-3 influences autoimmune diseases, including diabetes and multiple sclerosis, and its role in other inflammatory diseases including allergies and cancer is beginning to become clear. In tumor rejection model, soluble form of Tim-3 (sTim-3) significantly impaired T cell antitumor immunity, evidenced by decreased antitumor CTL activity and reduced amount of tumor-infiltrating lymphocytes in tumor. sTim-3 as an immunoregulatory molecule that may be involved in the negative regulation of T cell-mediated immune response.
Full Name
hepatitis A virus cellular receptor 2
References
  • Geng H, et al. (2006) Soluble form of T cell Ig mucin 3 is an inhibitory molecule in T cell-mediated immune response. J Immunol. 176(3): 1411-20.
  • Anderson AC, et al. (2006) TIM-3 in autoimmunity. Curr Opin Immunol. 18(6): 665-9.
  • Anderson DE. (2007) TIM-3 as a therapeutic target in human inflammatory diseases. Expert Opin Ther Targets. 11(8): 1005-9.
  • Pan HF, et al. (2010) TIM-3 as a new therapeutic target in systemic lupus erythematosus. Mol Biol Rep. 37(1): 395-8.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.