GRP78/HSPA5 cDNA ORF Clone, Rat, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

GRP78/HSPA5 cDNA ORF Clone, Rat, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1965 bp
Description
Full length Clone DNA of Rat heat shock protein 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

GRP78/HSPA5 Background Information

Full Name
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.