CIDEA cDNA ORF Clone, Rat, N-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

CIDEA cDNA ORF Clone, Rat, N-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Rat cell death-inducing DFFA-like effector a with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

CIDEA Background Information

The cell death-inducing DFFA (DNA fragmentation factor-alpha)-like effector A (CIDEA) gene is implicated as an important regulator of body weight in mice and humans and is therefore a candidate gene for human obesity. CIDEA alleles regulate human obesity through impact on basal metabolic rate and adipocyte TNF-alpha signaling. CIDEA alleles regulate human obesity through impact on basal metabolic rate and adipocyte TNF-alpha signaling. CIDEA has important metabolic effects in human fat cells and genetic variations in the human CIDEA gene have been correlated to the development of obesity. CIDEA overexpression induced actin cytoskeletal disruption, cell cycle arrest, release of pro-inflammatory cytokine IL-6 in a JNK-dependent manner; CIDEA mediated apoptotic cell death, decreased STAT3 phosphorylation and increased p53 acetylation was JNK independent.
Full Name
cell death-inducing DFFA-like effector a

CIDEA cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.