CD59 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

CD59 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
381 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus CD59 molecule, complement regulatory protein.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CD59 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: Alternative Names

CD59 cDNA ORF Clone, Rat

CD59 Background Information

CD59 glycoprotein, also known as 2 kDa homologous restriction factor, HRF2, MAC-inhibitory protein, Membrane attack complex inhibition factor, Membrane inhibitor of reactive lysis, MIC11, MIRL and CD59, is a cell membrane protein which contains one UPAR/Ly6 domain. CD59 is a small, highly glycosylated, GPI-linked protein, with a wide expression profile. The soluble form of CD59 from urine retains its specific complement binding activity, but exhibits greatly reduced ability to inhibit MAC assembly on cell membranes. CD59 is a potent inhibitor of the complement membrane attack complex (MAC) action. CD59 was first identified as a regulator of the terminal pathway of complement. It acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. This inhibitor appears to be species-specific. CD59 is involved in signal transduction for T-cell activation complexed to a protein tyrosine kinase. Defects in CD59 are the cause of CD59 deficiency (CD59D).
Full Name
CD59 molecule
References
  • Fletcher CM. et al., 1994, Structure. 2: 185-99.
  • Rudd PM. et al., 1997, J Biol Chem. 272: 7229-44.
  • Kimberley FC. et al., 2007, Mol Immunol. 44 (1-3): 73-81.
  • Gong Y. et al., 2007, Sci China C Life Sci. 50 (6): 773-9.
  • Picariello G. et al., 2008, Proteomics 8: 3833-47.
  • Heibeck TH. et al., 2009, J Proteome Res. 8: 3852-61.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.