CALB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag

Price:
Size:
Number:

CALB2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
816 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Rattus norvegicus calbindin 2
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

More Information About CALB2

Entrez Gene ID

CALB2 Background Information

Calretinin (CALB2) is a member of the EF-hand family of Ca(2+)-binding proteins and is expressed in a majority of poorly differentiated colon carcinoma and additionally in mesothelioma of the epithelioid and mixed type. Calretinin (CALB2) is a diagnostic marker for epithelioid mesothelioma. It is also a prognostic marker since patients with tumors expressing high calretinin levels have better overall survival. Silencing of calretinin decreases the viability of epithelioid mesothelioma cells. The calcium-binding protein calretinin (CALB2) is currently considered the most sensitive and specific marker for the diagnosis of malignant mesothelioma (MM). Calretinin (CALB2) is a diagnostic and prognostic marker in malignant pleural mesothelioma (MPM).
References
  • Kresoja-Rakic J, et al. (2016) Identification of cis- and trans-acting elements regulating calretinin expression in mesothelioma cells. Oncotarget 7 (16): 21272-21286.
  • Häner K, et al. (2010) A bipartite butyrate-responsive element in the human calretinin (calb2) promoter acts as a repressor in colon carcinoma cells but not in mesothelioma cells. J Cell Biochem 109 (3): 519-531.
  • Blum W, et al. (2018) Regulation of calretinin in malignant mesothelioma is mediated by septin 7 binding to the calb2 promoter. BMC Cancer 18 (1): 475.

CALB2 cDNA ORF Clone, Human, Related Products

CALB2 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.