ULBP1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

Price:
Size:
Number:

ULBP1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Mouse UL16 binding protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

More Information About ULBP1

Entrez Gene ID

ULBP1 cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Synonyms

A430108B07Rik cDNA ORF Clone, Mouse; MULT1 cDNA ORF Clone, Mouse

ULBP1 Background Information

UL16-binding proteins (ULBP) or retinoic acid early transcripts-1 (RAET1) are ligands to the activating receptor, NKG2D. Ten members of the human ULBP/RAET1 gene family have been identified to encode for potentially functional proteins, and have tissue-specific expressions. ULBP1, also known as RAET1I and NKG2DL1, together with at least ULBP 2 and 3, are well-known ligands for NKG2D, and activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. ULBP1 is expressed in T-cells, B-cells, erythroleukemia cell lines and in a wide range of tissues including heart, brain, lung, liver and bone marrow, as well as some tumor cells. As an unconventional member of the MHC class I family, ULBP1 function in immune responses, especially in cancer and infectious diseases. Unlike other ULBP members, ULBP1 is able to interact with soluble CMV glycoprotein UL16 in CMV infected cells. The interaction with UL16 blocked the interaction with the NKG2D receptor, and thus might escape the immune surveillance. Furthermore, UL16 also causes ULBP1 to be retained in the ER and cis-Golgi apparatus so that it does not reach the cell surface. The ULBP1 regulation may have implications for development of new therapeutic strategies against cancer cells.
Full Name
UL16 binding protein 1
References

    1.  Rölle, A. et al., 2003, J Immunol. 171(2): 902-908.  

    2.  López-Soto, A. et al., 2006, J Biol Chem. 281(41): 30419-30430.      

    3.  Song, H. et al., 2006, Cell Immunol. 239(1): 22-30.  

    4.  Eisele, G. et al., 2006, Brain. 129 (9): 2416-2425.   

    5.  Romphruk, AV. et al., 2009, Immunogenetics. 61(9): 611-617. 

    6.  Sutherland, C.L. et. al., 2002, J. Immunol. 168: 671-679.

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.