Sino Biological - 官方網站

RAB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

RAB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Mouse RAB5A, member RAS oncogene family with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RAB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Alternative Names

2410015H04Rik cDNA ORF Clone, Mouse; AI663973 cDNA ORF Clone, Mouse; AU021172 cDNA ORF Clone, Mouse; nnyRab5a cDNA ORF Clone, Mouse

RAB5 Background Information

Over-expression of RAB5A gene has been proved to be associated with neoplasia metastasis.Over-expression of RAB5A genes plays an important role in tumor invasion and metastatic phenotype formation of human lung adenocarcinoma cells; and antisense RNA can interrupt the translation of RAB5A gene.RAB5A was a directly target of miR-13a, and its mRNA and protein level was negatively regulated by miR-13a. Immunohistochemistry verified RAB5A was upregulated in breast cancer tissues. RAB5A gene was abnormally expressed in luteinized granulosa cells of obese patients with polycystic ovary syndrome, which may help explain high FSHR levels found in this syndrome.
Full Name
RAB5A, member RAS oncogene family
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait