Midkine Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

Midkine Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
423 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus midkine.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Midkine Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

Mek cDNA ORF Clone, Mouse; MK cDNA ORF Clone, Mouse

Midkine Background Information

Midkine (MK or MDK) also known as neurite growth-promoting factor 2 (NEGF2) is a basic heparin-binding growth factor of low molecular weight, and forms a family with pleiotrophin. Midkine is a retinoic acid-responsive, heparin-binding growth factor expressed in various cell types during embryogenesis. It promotes angiogenesis, cell growth, and cell migration. Midkine is also expressed in several carcinomas, suggesting that it may play a role in tumorigenesis, perhaps through its effects on angiogenesis. Midkine binds anaplastic lymphoma kinase (ALK) which induces ALK activation and subsequent phosphorylation of the insulin receptor substrate (IRS1), followed by the activation of mitogen-activated protein kinase (MAPK) and PI3-kinase and the induction of cell proliferation. Midkine is involved in neointima formation after arterial injury, possibly by mediating leukocyte recruitment. Also involved in early fetal adrenal gland development. Midkine exhibited increased expression in the breast carcinomas but showed much lower expression in the normal breast tissue. Thus, it can be used as a breast carcinomas marker.
Full Name
midkine (neurite growth-promoting factor 2)
References
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Muramatsu H, et al. (1993) Midkine, a retinoic acid-inducible growth/differentiation factor: immunochemical evidence for the function and distribution. Dev Biol. 159(2): 392-402.
  • Muramatsu T. (2002) Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis. J Biochem. 132(3): 359-71.
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.