Hsp27/HSPB1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

Hsp27/HSPB1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Mouse heat shock protein 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Hsp27/HSPB1 cDNA ORF Clone, Mouse, untagged: Synonyms

27kDa cDNA ORF Clone, Mouse; Hsp25 cDNA ORF Clone, Mouse

Hsp27/HSPB1 Background Information

Full Name
heat shock 27kDa protein 1
Research Areas
Related Pathways
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.