Hsp27/HSPB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag

Price:
Size:
Number:

Hsp27/HSPB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Mouse heat shock protein 1 with N terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Hsp27/HSPB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag: Synonyms

27kDa cDNA ORF Clone, Mouse; Hsp25 cDNA ORF Clone, Mouse

Hsp27/HSPB1 Background Information

Full Name
heat shock 27kDa protein 1
Research Areas
Related Pathways
  • VEGF Signaling Pathway
    VEGF Signaling Pathway
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.