GRP78/HSPA5 cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

GRP78/HSPA5 cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1968 bp
Description
Full length Clone DNA of Mouse heat shock protein 5
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About GRP78/HSPA5

Entrez Gene ID

GRP78/HSPA5 cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

AL022860 cDNA ORF Clone, Mouse; AU019543 cDNA ORF Clone, Mouse; baffled cDNA ORF Clone, Mouse; Bip cDNA ORF Clone, Mouse; D2Wsu141e cDNA ORF Clone, Mouse; D2Wsu17e cDNA ORF Clone, Mouse; Grp78 cDNA ORF Clone, Mouse; Hsce70 cDNA ORF Clone, Mouse; mBiP cDNA ORF Clone, Mouse; SEZ-7 cDNA ORF Clone, Mouse; Sez7 cDNA ORF Clone, Mouse

GRP78/HSPA5 Background Information

Full Name
heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.