GPR56 cDNA ORF Clone, Mouse, C-OFPSpark® tag

Price:
Size:
Number:

GPR56 cDNA ORF Clone, Mouse, C-OFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2079 bp
Description
Full length Clone DNA of Mouse adhesion G protein-coupled receptor G1 with C terminal OFPSpark / RFP tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GPR56 Background Information

ADGRG1 (Adhesion G Protein-Coupled Receptor G1, also known as GPR56) is a Protein Coding gene. GPR56 is a member of an adhesion G protein-coupled receptor family with a very long N-terminal stalk and seven transmembrane domains. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. GPR56 may be a target for the treatment of type 2 diabetes. GPR56 inhibits melanoma metastatic growth by impeding the expansion of micrometastases to macrometastases. GPR56 loss of function promotes mesenchymal differentiation and radioresistance of glioma initiating cells both in vitro and in vivo. Diseases associated with ADGRG1 include Polymicrogyria, Bilateral Frontoparietal, and Polymicrogyria, Bilateral Perisylvian, Autosomal Recessive.
Full Name
adhesion G protein-coupled receptor G1
References
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.

GPR56 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.