Growth Hormone Receptor cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag

1/1
Price:
Size:
Number:

Growth Hormone Receptor cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1992 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse growth hormone receptor, transcript variant 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI(two restrictionsites) + XbaI(6kb+1.26kb+0.74kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

Growth Hormone Receptor cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Growth Hormone Receptor cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Growth Hormone Receptor cDNA ORF Clone, Mouse, C-DYKDDDDK (Flag®) tag: Alternative Names

GHBP cDNA ORF Clone, Mouse; GHR/BP cDNA ORF Clone, Mouse

Growth Hormone Receptor Background Information

Growth hormone receptor, also known as GH receptor and GHR, is a single-pass type I membrane protein which belongs to thetype I cytokine receptor family and type 1 subfamily. GHR contains onefibronectin type-III domain. Growth hormone receptor / GHR is expressed in various tissues with high expression in liver and skeletal muscle. Isoform4of GHR is predominantly expressed in kidney, bladder, adrenal gland and brain stem. Isoform1 expression of GHR in placenta is predominant in chorion and decidua. Isoform4is highly expressed in placental villi. Isoform2of GHR is expressed in lung, stomach and muscle. Growth hormone receptor / GHR is a receptor for pituitary gland growth hormone. It is involved in regulating postnatal body growth. On ligand binding, it couples to the JAK2 / STAT5 pathway. Isoform2of GHR up-regulates the production of GHBP and acts as a negative inhibitor of GH signaling. Defects in GHR are a cause of Laron syndrome (LARS) which is a severe form of growth hormone insensitivity characterized by growth impairment, short stature, dysfunctional growth hormone receptor, and failure to generate insulin-like growth factor I in response to growth hormone. Defects in GHR may also be a cause of idiopathic short stature autosomal (ISSA) which is defined by a subnormal rate of growth.
Full Name
growth hormone receptor
References
  • Leung DW. et al., 1987, Nature. 330:537-43.
  • Sobrier M-L. et al., 1997, J Clin Endocrinol Metab. 82: 435-7.
  • Enberg B. et al., 2000, Eur J Endocrinol. 143: 71-6.
  • Pantel J. et al., 2000, J Biol Chem. 275: 18664-9.
  • Jorge AAL. et al., 2004, Clin Endocrinol. (Oxf.) 60: 36-40.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.