Frizzled 5 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

Frizzled 5 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1758 bp
Description
Full length Clone DNA of Mouse frizzled homolog 5 (Drosophila) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Frizzled 5 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

5330434N09Rik cDNA ORF Clone, Mouse; AI427138 cDNA ORF Clone, Mouse; Fz-5 cDNA ORF Clone, Mouse; Fz5 cDNA ORF Clone, Mouse; mFz5 cDNA ORF Clone, Mouse

Frizzled 5 Background Information

Wnt signaling is involved in a variety of embryonic development processes of nonvertebrates and vertebrates, where it determines cell motility, cell polarity, differentiation, proliferation and apoptosis, as well as formation of neural synapses. Various homologs of the Wingless protein, termed WNT factors, represent key mediators and act through a receptor complex comprised of members of the Frizzled and low density lipoprotein-related receptors (LRP). 19 WNTs, 1 Frizzled, and 2 LRP proteins have been identified. Frizzled is a family of G protein-coupled receptor proteins consisting of a divergent signal peptide, a highly conserved extracellular cysteine-rich domain (CRD), a variable-length linker region, a seven-pass transmembrane domain, and a variable-length C-terminal tail.Frizzled 5 (FZD5) is believed to be the receptor for the Wnt5A ligand, and also interactions with Wnt1B, Wnt2B, and Wnt 7A functionally. Recent studies of WNT5A/Frizzled-5 signaling have revealed an unexpected and novel role in orchestrating adaptive immunity in response to microbial stimulation. In addition, FZD5 is also implicated in the survival of mature neurons in the parafascicular nucleus of the thalamus.
Full Name
frizzled class receptor 5
References
  • Wang Y., et al.,(1996), A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. J. Biol. Chem. 271:4468-4476.
  • Saitoh T., et al., (2001), Molecular cloning and characterization of human Frizzled-5 gene on chromosome 2q33.3-q34 region.Int. J. Oncol. 19:105-110.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.