EGFR cDNA ORF Clone, Mouse, C-GFPSpark® tag

1/2
Price:
Size:
Number:

EGFR cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3633 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 40 T>C, 1725 A>G and 2799 G>A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse epidermal growth factor receptor with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + NotI (6kb + 4.36kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EGFR cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EGFR cDNA ORF Clone, Mouse, C-GFPSpark® tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

EGFR cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

9030024J15Rik cDNA ORF Clone, Mouse; AI552599 cDNA ORF Clone, Mouse; Erbb cDNA ORF Clone, Mouse; Errb1 cDNA ORF Clone, Mouse; Errp cDNA ORF Clone, Mouse; wa-2 cDNA ORF Clone, Mouse; wa2 cDNA ORF Clone, Mouse; Wa5 cDNA ORF Clone, Mouse

EGFR Background Information

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.
Full Name
epidermal growth factor receptor
Related Pathways
  • EGFR Signaling Pathway
    EGFR Signaling Pathway
  • Jak-Stat Signaling Pathway
    Jak-Stat Signaling Pathway
References
  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
  • TFF3 is a ligand for LINGO2 that de-represses EGFR to control disease outcome during colitis and gastrointestinal nematode infection
    Author
    Ji, Y;Wei, Y;Park, J;Hung, L;Young, T;Herbine, K;Oniskey, T;Pastore, C;Nieves, W;Somsouk, M;Herbert, D;
    Year
    2018
    Journal
    bioRxiv
    Application
    expression
  • Intracellular hydrogelation preserves fluid and functional cell membrane interfaces for biological interactions
    Author
    Lin, JC;Chien, CY;Lin, CL;Yao, BY;Chen, YI;Liu, YH;Fang, ZS;Chen, JY;Chen, WY;Lee, NN;Chen, HW;Hu, CJ;
    Year
    2019
    Journal
    Nat Commun
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.