Sino Biological - 官方網站

DKK3 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

DKK3 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Mouse dickkopf homolog 3 (Xenopus laevis) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DKK3 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

AW061014 cDNA ORF Clone, Mouse; C87148 cDNA ORF Clone, Mouse

DKK3 Background Information

DKK3 (dickkopf related protein 3) is a member of the dickkopf-related family consisting of DKK1, DKK2, DKK3 and DKK4. It is a secreted protein, and also known as REIC (Reduced Expansion in Immortalized Cells). The DKK3 protein is proposed to function as a secreted tumor suppressor since it is downregulated in a number of cancer cells and prostate cancer tissue and may be a promising candidate molecule for therapeutic interference. DKK3 protein is also a negative regulator of beta-catenin and its downregulation contribute to an activation of the beta-catenin signaling pathway.
Full Name
dickkopf WNT signaling pathway inhibitor 3
References
  • Yue W, et al., 2008. Downregulation of Dkk3 activates beta-catenin/TCF-4 signaling in lung cancer. Carcinogenesis, 29 (1): 84-92.
  • Ding Z, et al., 2009. Promoter methylation and mRNA expression of DKK3 and WIF-1 in hepatocellular carcinoma. World J Gastroenterol, 15 (21):2595-601.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait