CIDEA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CIDEA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
654 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus cell death-inducing DNA fragmentation factor, alpha subunit-like effector A.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CIDEA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

AW212747 cDNA ORF Clone, Mouse

CIDEA Background Information

The cell death-inducing DFFA (DNA fragmentation factor-alpha)-like effector A (CIDEA) gene is implicated as an important regulator of body weight in mice and humans and is therefore a candidate gene for human obesity. CIDEA alleles regulate human obesity through impact on basal metabolic rate and adipocyte TNF-alpha signaling. CIDEA alleles regulate human obesity through impact on basal metabolic rate and adipocyte TNF-alpha signaling. CIDEA has important metabolic effects in human fat cells and genetic variations in the human CIDEA gene have been correlated to the development of obesity. CIDEA overexpression induced actin cytoskeletal disruption, cell cycle arrest, release of pro-inflammatory cytokine IL-6 in a JNK-dependent manner; CIDEA mediated apoptotic cell death, decreased STAT3 phosphorylation and increased p53 acetylation was JNK independent.
Full Name
cell death-inducing DFFA-like effector a

CIDEA cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.