CHOP/DDIT3 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

CHOP/DDIT3 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Mouse DNA-damage inducible transcript 3 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CHOP/DDIT3 cDNA ORF Clone, Mouse, N-HA tag: Synonyms

chop cDNA ORF Clone, Mouse; CHOP-10 cDNA ORF Clone, Mouse; CHOP10 cDNA ORF Clone, Mouse; gadd153 cDNA ORF Clone, Mouse

CHOP/DDIT3 Background Information

DDIT3, also known as GADD153 or CHOP, encodes a basic leucine zipper transcription factor of the dimer forming C/EBP family. DDIT3 is known as a key regulator of cellular stress response. DNA-damage-inducible transcript 3 (DDIT3), a candidate tumor suppressor gene (TSG), has been found involved in the regulation of cellular growth and differentiation. The aberrant methylation of DDIT3 occurs in CML frequently.
Full Name
DNA-damage-inducible transcript 3
Related Pathways
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.