CHOP/DDIT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag

Price:
Size:
Number:

CHOP/DDIT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
507 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Mus musculus DNA-damage inducible transcript 3.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

CHOP/DDIT3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag: Synonyms

chop cDNA ORF Clone, Mouse; CHOP-10 cDNA ORF Clone, Mouse; CHOP10 cDNA ORF Clone, Mouse; gadd153 cDNA ORF Clone, Mouse

CHOP/DDIT3 Background Information

DDIT3, also known as GADD153 or CHOP, encodes a basic leucine zipper transcription factor of the dimer forming C/EBP family. DDIT3 is known as a key regulator of cellular stress response. DNA-damage-inducible transcript 3 (DDIT3), a candidate tumor suppressor gene (TSG), has been found involved in the regulation of cellular growth and differentiation. The aberrant methylation of DDIT3 occurs in CML frequently.
Full Name
DNA-damage-inducible transcript 3
Related Pathways
  • P38 MAPK Signaling Pathway
    P38 MAPK Signaling Pathway
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.