MERS-CoV (NCoV / Novel coronavirus) Spike Protein Gene cDNA Clone / ORF Clone (Codon Optimized), expression ready, C-GFPSpark-tagged

1/2
Price:
Size:
Number:

MERS-CoV (NCoV / Novel coronavirus) Spike Protein Gene cDNA Clone / ORF Clone (Codon Optimized), expression ready, C-GFPSpark-tagged: General Information

Gene
Species
MERS-CoV
RefSeq ORF Size
4062 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AFS88936.1.
Description
Full length Clone DNA of MERS-CoV (NCoV / Novel coronavirus) Spike protein with C terminal GFPSpark tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 4.62kb)
Tag Sequence
GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Coronavirus spike cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MERS-CoV (NCoV / Novel coronavirus) Spike Protein Gene cDNA Clone / ORF Clone (Codon Optimized), expression ready, C-GFPSpark-tagged: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.

MERS-CoV (NCoV / Novel coronavirus) Spike Protein Gene cDNA Clone / ORF Clone (Codon Optimized), expression ready, C-GFPSpark-tagged: Synonyms

coronavirus s1 cDNA ORF Clone, MERS-CoV; coronavirus s2 cDNA ORF Clone, MERS-CoV; coronavirus spike cDNA ORF Clone, MERS-CoV; cov spike cDNA ORF Clone, MERS-CoV; ncov RBD cDNA ORF Clone, MERS-CoV; ncov s1 cDNA ORF Clone, MERS-CoV; ncov s2 cDNA ORF Clone, MERS-CoV; ncov spike cDNA ORF Clone, MERS-CoV; RBD cDNA ORF Clone, MERS-CoV; S cDNA ORF Clone, MERS-CoV; s1 cDNA ORF Clone, MERS-CoV; Spike RBD cDNA ORF Clone, MERS-CoV

Coronavirus spike Background Information

The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host cell. Known receptors bind S1 are ACE2, angiotensin-converting enzyme 2; DPP4, dipeptidyl peptidase-4; APN, aminopeptidase N; CEACAM, carcinoembryonic antigen-related cell adhesion molecule 1; Sia, sialic acid; O-ac Sia, O-acetylated sialic acid. The spike is essential for both host specificity and viral infectivity. The term 'peplomer' is typically used to refer to a grouping of heterologous proteins on the virus surface that function together. The spike (S) glycoprotein of coronaviruses is known to be essential in the binding of the virus to the host cell at the advent of the infection process. It's been reported that SARS-CoV-2 (COVID-19 coronavirus, 2019-nCoV) can infect the human respiratory epithelial cells through interaction with the human ACE2 receptor. The spike protein is a large type I transmembrane protein containing two subunits, S1 and S2. S1 mainly contains a receptor binding domain (RBD), which is responsible for recognizing the cell surface receptor. S2 contains basic elements needed for the membrane fusion. The S protein plays key parts in the induction of neutralizing-antibody and T-cell responses, as well as protective immunity. The main functions for the Spike protein are summarized as: Mediate receptor binding and membrane fusion; Defines the range of the hosts and specificity of the virus; Main component to bind with the neutralizing antibody; Key target for vaccine design; Can be transmitted between different hosts through gene recombination or mutation of the receptor binding domain (RBD), leading to a higher mortality rate.
References
  • Shen S, et al. (2007) Expression, glycosylation, and modification of the spike (S) glycoprotein of SARS CoV. Methods Mol Biol. 379: 127-35.
  • Du L, et al. (2009) The spike protein of SARS-CoV--a target for vaccine and therapeutic development. Nat Rev Microbiol. 7 (3): 226-36.
  • Xiao X, et al. (2004) The SARS-CoV S glycoprotein. Cell Mol Life Sci. 61 (19-20): 2428-30.

Coronavirus spike cDNA ORF Clone, 2019-nCoV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.