ULBP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag

1/2
Price:
Size:
Number:

ULBP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
774 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human UL16 binding protein 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+0.77kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Note: Flag® is a registered trademark of Sigma Aldrich Biotechnology LP. It is used here for informational purposes only.

ULBP1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ULBP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

ULBP1 cDNA ORF Clone, Human, C-DYKDDDDK (Flag®) tag: Synonyms

RAET1I cDNA ORF Clone, Human

ULBP1 Background Information

UL16-binding proteins (ULBP) or retinoic acid early transcripts-1 (RAET1) are ligands to the activating receptor, NKG2D. Ten members of the human ULBP/RAET1 gene family have been identified to encode for potentially functional proteins, and have tissue-specific expressions. ULBP1, also known as RAET1I and NKG2DL1, together with at least ULBP 2 and 3, are well-known ligands for NKG2D, and activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. ULBP1 is expressed in T-cells, B-cells, erythroleukemia cell lines and in a wide range of tissues including heart, brain, lung, liver and bone marrow, as well as some tumor cells. As an unconventional member of the MHC class I family, ULBP1 function in immune responses, especially in cancer and infectious diseases. Unlike other ULBP members, ULBP1 is able to interact with soluble CMV glycoprotein UL16 in CMV infected cells. The interaction with UL16 blocked the interaction with the NKG2D receptor, and thus might escape the immune surveillance. Furthermore, UL16 also causes ULBP1 to be retained in the ER and cis-Golgi apparatus so that it does not reach the cell surface. The ULBP1 regulation may have implications for development of new therapeutic strategies against cancer cells.
Full Name
UL16 binding protein 1
References

    1.  Rölle, A. et al., 2003, J Immunol. 171(2): 902-908.  

    2.  López-Soto, A. et al., 2006, J Biol Chem. 281(41): 30419-30430.      

    3.  Song, H. et al., 2006, Cell Immunol. 239(1): 22-30.  

    4.  Eisele, G. et al., 2006, Brain. 129 (9): 2416-2425.   

    5.  Romphruk, AV. et al., 2009, Immunogenetics. 61(9): 611-617. 

    6.  Sutherland, C.L. et. al., 2002, J. Immunol. 168: 671-679.

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait U.S.A.